Order Kazusa clone(s) from : ![]() |
Product ID | ORK01636 |
---|---|
Accession No | AB051556 |
Description | helicase with zinc finger 2, transcriptional coactivator, transcript variant 2 |
Clone name | af00171 |
Vector information | |
cDNA sequence | DNA sequence (7484 bp) Predicted protein sequence (2114 aa) |
HaloTag ORF Clone |
FHC01636
![]() |
Flexi ORF Clone | FXC01636 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1769
by Kazusa Mouse cDNA Project
|
Note | We replaced pj00758, former representative clones for KIAA1769 with af00171. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1137 bp |
---|---|
Genome contig ID | gi51511747r_61559908 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 61659908 | 61669551 | 14 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AATGAGCGGCTGCAAAACCTG |
---|---|
Primer_r | GTCTTCAGCTTGCTCTTGTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | AATGAGCGGCTGCAAAACCTG |
Primer_r | GTCTTCAGCTTGCTCTTGTAG |
PCR product length | 146(250) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |