Order Kazusa clone(s) from : ![]() |
Product ID | ORK06023 |
---|---|
Accession No | AB046851 |
Description | Mov10 RISC complex RNA helicase, transcript variant 3 |
Clone name | fh15959s1 |
Vector information | |
cDNA sequence | DNA sequence (4100 bp) Predicted protein sequence (1032 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1631
by Kazusa Mouse cDNA Project
|
Note | We replaced fh15959, former representative clones for KIAA1631 with fh15959s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 227 bp |
---|---|
Genome contig ID | gi89161185f_112918972 |
PolyA signal sequence (AAGAAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (125909 - 125958) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 113018843 | 113044879 | 22 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR000886 | 1029 | 1032 | PS00014 | Endoplasmic reticulum targeting sequence |
![]() |
Primer_f | TGTCTTCCCTCAGTCCTTCCA |
---|---|
Primer_r | GGATCGGAGGAATGTTTAATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |