Order Kazusa clone(s) from : ![]() |
Product ID | ORK07485 |
---|---|
Accession No | AB051516 |
Description | zinc finger protein 518B |
Clone name | pg00954 |
Vector information | |
cDNA sequence | DNA sequence (6295 bp) Predicted protein sequence (1020 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1729
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3231 bp |
---|---|
Genome contig ID | gi89161207r_9950603 |
PolyA signal sequence (AATAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 10050603 | 10056889 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 136 | 159 | PF00096 | Zinc finger |
HMMSmart | IPR015880 | 81 | 103 | SM00355 | Zinc finger |
IPR015880 | 108 | 130 | SM00355 | Zinc finger | |
IPR015880 | 136 | 159 | SM00355 | Zinc finger | |
IPR015880 | 982 | 1004 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 108 | 135 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 984 | 1004 | PS00028 | Zinc finger |
![]() |
Primer_f | GGTTTTGTGGGCGACTGTATG |
---|---|
Primer_r | ACTGAATCTTGGTGGAGGGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |