Order Kazusa clone(s) from : ![]() |
Product ID | ORK00901 |
---|---|
Accession No | AB051509 |
Description | Rho GTPase activating protein 35 |
Clone name | pf00674s1 |
Vector information | |
cDNA sequence | DNA sequence (7692 bp) Predicted protein sequence (1499 aa) |
HaloTag ORF Clone |
FHC00901
![]() |
Flexi ORF Clone | FXC00901 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1722
by Kazusa Mouse cDNA Project
|
Note | We replaced pf00674, former representative clones for KIAA1722 with pf00674s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3192 bp |
---|---|
Genome contig ID | gi42406306f_52013773 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (185633 - 185682) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 52113773 | 52199404 | 7 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013753 | 212 | 249 | PF00071 | Ras |
IPR002713 | 487 | 547 | PF01846 | FF | |
IPR000198 | 1262 | 1413 | PF00620 | RhoGAP | |
HMMSmart | IPR002713 | 270 | 327 | SM00441 | FF |
IPR002713 | 369 | 422 | SM00441 | FF | |
IPR002713 | 429 | 483 | SM00441 | FF | |
IPR002713 | 485 | 539 | SM00441 | FF | |
IPR000198 | 1259 | 1433 | SM00324 | RhoGAP | |
ProfileScan | IPR000198 | 1249 | 1436 | PS50238 | RhoGAP |
![]() |
Primer_f | TTTATGAACTGGAGCTGGATG |
---|---|
Primer_r | GTCTCCTTTGTTGGGTGGTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |