KIAA1703

Product ID	ORK05704
Accession No	AB051490
Description	zinc finger protein 407
Clone name	fj16891
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4701 bp) Predicted protein sequence (1165 aa)
Source	Human fetal brain
Rouge ID	mKIAA1703 by Kazusa Mouse cDNA Project

Length: 4701 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1201 bp
Genome contig ID	gi51511735f_70375211
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTGTTTTCTTTGAAATAAAATTATAACGTTAAAAG
Flanking genome sequence (531404 - 531453)	----+--------+--------+--------+--------+----* ATCACGATGGCATGTTATTTTCAGCAGCCAGTGGTGGGCAGCTGTGGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	70475211	70906613	8	99.2	Perfect prediction

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0G0	100.0	Zinc finger pro...	Homo sapiens
XP_001085704	97.4	zinc finger pro...	Macaca mulatta
XP_523972	99.4	hypothetical pr...	Pan troglodytes
XP_225679	81.4	similar to Zinc...	Rattus norvegicus
EDL75191	81.4	similar to zinc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095928	1.2e-23	28.6	KIAA2007
AB046831	1.8e-23	32.1	KIAA1611
AB040906	1.5e-22	30.8	KIAA1473
AB037770	1.8e-22	32.3	KIAA1349
AB037852	4.2e-22	28.0	KIAA1431

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	361	385	PF00096	Zinc finger
	IPR007087	403	426	PF00096	Zinc finger
	IPR007087	484	506	PF00096	Zinc finger
	IPR007087	512	535	PF00096	Zinc finger
	IPR007087	545	567	PF00096	Zinc finger
	IPR007087	573	597	PF00096	Zinc finger
	IPR007087	631	653	PF00096	Zinc finger
	IPR007087	690	713	PF00096	Zinc finger
HMMSmart	IPR015880	331	354	SM00355	Zinc finger
	IPR015880	361	385	SM00355	Zinc finger
	IPR015880	403	426	SM00355	Zinc finger
	IPR015880	454	478	SM00355	Zinc finger
	IPR015880	484	506	SM00355	Zinc finger
	IPR015880	512	535	SM00355	Zinc finger
	IPR015880	545	567	SM00355	Zinc finger
	IPR015880	573	597	SM00355	Zinc finger
	IPR015880	603	625	SM00355	Zinc finger
	IPR015880	631	653	SM00355	Zinc finger
	IPR015880	659	684	SM00355	Zinc finger
	IPR015880	690	713	SM00355	Zinc finger
ProfileScan	IPR007087	361	390	PS50157	Zinc finger
	IPR007087	403	426	PS50157	Zinc finger
	IPR007087	512	540	PS50157	Zinc finger
	IPR007087	545	572	PS50157	Zinc finger
	IPR007087	573	602	PS50157	Zinc finger
	IPR007087	603	630	PS50157	Zinc finger
	IPR007087	631	658	PS50157	Zinc finger
ScanRegExp	IPR007087	363	385	PS00028	Zinc finger
	IPR007087	405	426	PS00028	Zinc finger
	IPR007087	514	535	PS00028	Zinc finger
	IPR007087	547	567	PS00028	Zinc finger
	IPR007087	575	597	PS00028	Zinc finger

Primer_f	ATGGACTGAGTGGACTGAATG
Primer_r	ACACTGGCCTGCTCATTTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AGGGTGCCCAGATCATCATGC
Primer_r	AGCTCTGTCAGGATGTAGTGC
PCR product length	169 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles