Order Kazusa clone(s) from : ![]() |
Product ID | ORK00880 |
---|---|
Accession No | AB046837 |
Description | Scm-like with four mbt domains 2, transcript variant 2 |
Clone name | fj13890 |
Vector information | |
cDNA sequence | DNA sequence (4259 bp) Predicted protein sequence (904 aa) |
HaloTag ORF Clone |
FHC00880
![]() |
Flexi ORF Clone | FXC00880 |
Source | Human fetal brain |
Rouge ID |
mKIAA1617
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1483 bp |
---|---|
Genome contig ID | gi89161187r_7144255 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 7244255 | 7491309 | 21 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004092 | 88 | 163 | PF02820 | Mbt repeat |
IPR004092 | 203 | 270 | PF02820 | Mbt repeat | |
IPR004092 | 314 | 391 | PF02820 | Mbt repeat | |
IPR004092 | 422 | 492 | PF02820 | Mbt repeat | |
IPR011510 | 831 | 897 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR004092 | 54 | 154 | SM00561 | Mbt repeat |
IPR004092 | 162 | 266 | SM00561 | Mbt repeat | |
IPR004092 | 276 | 382 | SM00561 | Mbt repeat | |
IPR004092 | 390 | 487 | SM00561 | Mbt repeat | |
IPR001660 | 831 | 897 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR004092 | 54 | 154 | PS51079 | Mbt repeat |
IPR004092 | 162 | 266 | PS51079 | Mbt repeat | |
IPR004092 | 276 | 382 | PS51079 | Mbt repeat | |
IPR004092 | 390 | 487 | PS51079 | Mbt repeat |
![]() |
Primer_f | AGATCGAGAGAGTCAAAGTGG |
---|---|
Primer_r | ACATGGAAACAGCTCACAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | AGATCGAGAGAGTCAAAGTGG |
Primer_r | ACATGGAAACAGCTCACAGGC |
PCR product length | 219 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |