Order Kazusa clone(s) from : ![]() |
Product ID | ORK04903 |
---|---|
Accession No | AB040892 |
Description | EPH receptor A8 |
Clone name | fh16961 |
Vector information | |
cDNA sequence | DNA sequence (4417 bp) Predicted protein sequence (853 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1459
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1853 bp |
---|---|
Genome contig ID | gi89161185f_22675592 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (127084 - 127133) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 22775592 | 22802674 | 15 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001090 | 1 | 53 | PD001495 | Ephrin receptor |
IPR000719 | 490 | 747 | PD000001 | Protein kinase | |
FPrintScan | IPR003962 | 190 | 199 | PR00014 | Fibronectin |
IPR003962 | 315 | 325 | PR00014 | Fibronectin | |
IPR003962 | 338 | 356 | PR00014 | Fibronectin | |
IPR003962 | 356 | 370 | PR00014 | Fibronectin | |
IPR001245 | 561 | 574 | PR00109 | Tyrosine protein kinase | |
IPR001245 | 598 | 616 | PR00109 | Tyrosine protein kinase | |
IPR001245 | 648 | 658 | PR00109 | Tyrosine protein kinase | |
IPR001245 | 667 | 689 | PR00109 | Tyrosine protein kinase | |
IPR001245 | 711 | 733 | PR00109 | Tyrosine protein kinase | |
HMMPfam | IPR001090 | 1 | 52 | PF01404 | Ephrin receptor |
IPR003961 | 177 | 273 | PF00041 | Fibronectin | |
IPR003961 | 285 | 372 | PF00041 | Fibronectin | |
IPR001245 | 483 | 740 | PF07714 | Tyrosine protein kinase | |
IPR001660 | 779 | 840 | PF00536 | Sterile alpha motif SAM | |
HMMSmart | IPR003961 | 177 | 267 | SM00060 | Fibronectin |
IPR003961 | 288 | 369 | SM00060 | Fibronectin | |
IPR001245 | 483 | 740 | SM00219 | Tyrosine protein kinase | |
IPR002290 | 483 | 744 | SM00220 | Serine/threonine protein kinase | |
IPR001660 | 775 | 842 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR003961 | 176 | 278 | PS50853 | Fibronectin |
IPR003961 | 284 | 379 | PS50853 | Fibronectin | |
IPR000719 | 483 | 744 | PS50011 | Protein kinase | |
IPR001660 | 782 | 842 | PS50105 | Sterile alpha motif SAM | |
ScanRegExp | IPR001426 | 33 | 53 | PS00790 | Receptor tyrosine kinase |
IPR001426 | 95 | 115 | PS00791 | Receptor tyrosine kinase | |
IPR013032 | 108 | 121 | PS01186 | EGF-like region | |
IPR000719 | 489 | 515 | PS00107 | Protein kinase | |
IPR008266 | 604 | 616 | PS00109 | Tyrosine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 28 | GFYLAFQDIGACLAILSLRIYY | 49 | SECONDARY | 22 |
2 | 390 | TIVWICLTLITGLVVLLLLLIC | 411 | PRIMARY | 22 |
![]() |
Primer_f | CAGGCACCTTCTCTTTTCCAG |
---|---|
Primer_r | GAGATCCCATGACCTTGTGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |