Order Kazusa clone(s) from : ![]() |
Product ID | ORK04550 |
---|---|
Accession No | AB037837 |
Description | chromodomain helicase DNA binding protein 7 |
Clone name | hh02957s1 |
Vector information | |
cDNA sequence | DNA sequence (5901 bp) Predicted protein sequence (1966 aa) |
Source | Human adult brain |
Note | We replaced hh02957, former representative clones for KIAA1416 with hh02957s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 0 bp |
---|---|
Genome contig ID | gi51511724f_61775549 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (164692 - 164741) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 61875549 | 61940239 | 34 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000953 | 38 | 100 | PF00385 | Chromo |
IPR000953 | 120 | 173 | PF00385 | Chromo | |
IPR000330 | 209 | 496 | PF00176 | SNF2-related | |
IPR001650 | 563 | 642 | PF00271 | DNA/RNA helicase | |
IPR006576 | 1802 | 1851 | PF07533 | BRK | |
IPR006576 | 1880 | 1924 | PF07533 | BRK | |
HMMSmart | IPR000953 | 37 | 102 | SM00298 | Chromo |
IPR000953 | 118 | 175 | SM00298 | Chromo | |
IPR014001 | 202 | 403 | SM00487 | DEAD-like helicases | |
IPR001650 | 558 | 642 | SM00490 | DNA/RNA helicase | |
IPR006576 | 1802 | 1851 | SM00592 | BRK | |
IPR006576 | 1880 | 1924 | SM00592 | BRK | |
ProfileScan | IPR000953 | 38 | 105 | PS50013 | Chromo |
IPR000953 | 120 | 185 | PS50013 | Chromo | |
IPR014021 | 218 | 392 | PS51192 | Helicase | |
IPR001650 | 532 | 702 | PS51194 | DNA/RNA helicase |
![]() |
Primer_f | TCAGAAACCGAAACAGAAACG |
---|---|
Primer_r | GACTCAGGAACAAAACCAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGGGCCTGGATAAAGCTGTG |
Primer_r | TTTAGACCCTTCATCCTCCTC |
PCR product length | 150 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |