KIAA1564

Product ID	ORK04551
Accession No	AB046784
Description	chromodomain helicase DNA binding protein 8
Clone name	fh20840s1
Vector information	The cDNA fragment was inserted at the XhoI-NotI site of the ... The cDNA fragment was inserted at the XhoI-NotI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 site (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AG GCTCTTC-5' end of cDNA, GAGCTCCACC GCGGTGGCGG CCGCTTTTTT TTTTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7426 bp) Predicted protein sequence (2432 aa)
Source	Human fetal brain
Rouge ID	mKIAA1564 by Kazusa Mouse cDNA Project
Note	We replaced fh20840 and ha02583, former representative clones for KIAA1564 with fh20840s1. (2002/5/10,2003/8/28)

Length: 7426 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	127 bp
Genome contig ID	gi51511730r_20823485
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGGGGAAGTCCAGGACTCCAGGAGGTGAAAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGTACCTGATTGCTCCCAATTATGAGAGGATTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	20923485	20969195	37	99.9	Perfect prediction

Length: 2432 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001153522	100.0	chromodomain he...	Pan troglodytes
XP_001096619	99.6	similar to chro...	Macaca mulatta
EDL88472	96.5	chromodomain he...	Rattus norvegicus
EDL42251	96.4	mCG18716, isofo...	Mus musculus
ABB02259	96.3	chromodomain he...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037837	4e-166	59.2	KIAA1416
AB002306	1.6e-159	52.8	KIAA0308
AB037756	1.6e-117	65.4	KIAA1335
AB007913	4.8e-16	48.2	KIAA0444
AB002307	2.7e-10	27.5	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000257	950	1093	PD003225	Uroporphyrinogen decarboxylase (URO-D)
HMMPfam	IPR000953	493	555	PF00385	Chromo
	IPR000953	575	629	PF00385	Chromo
	IPR000330	665	952	PF00176	SNF2-related
	IPR001650	1019	1098	PF00271	DNA/RNA helicase
	IPR006576	2161	2205	PF07533	BRK
	IPR006576	2230	2266	PF07533	BRK
HMMSmart	IPR000953	491	557	SM00298	Chromo
	IPR000953	573	631	SM00298	Chromo
	IPR014001	658	860	SM00487	DEAD-like helicases
	IPR001650	1014	1098	SM00490	DNA/RNA helicase
	IPR006576	2161	2205	SM00592	BRK
	IPR006576	2230	2270	SM00592	BRK
ProfileScan	IPR000953	575	641	PS50013	Chromo
	IPR014021	674	848	PS51192	Helicase
	IPR001650	988	1139	PS51194	DNA/RNA helicase

Primer_f	ACGTTTGGTGTGGAATATGAC
Primer_r	GGGCTCAATGAACAGGTTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-