| Order Kazusa clone(s) from :  Japan
 || 
Other countries | 
| Product ID | ORK04547 | 
|---|---|
| Accession No | AB007913 | 
| Description | chromodomain helicase DNA binding protein 5 | 
| Clone name | hg00035 | 
| Vector information | |
| cDNA sequence | DNA sequence (6618 bp) Predicted protein sequence (978 aa) | 
| Source | Human adult brain | 
| Rouge ID | mKIAA0444
    
    by Kazusa Mouse cDNA Project | 
 Length: 6618 bp
 Length: 6618 bp Physical map
 Physical map 
     Restriction map
 Restriction map Prediction of protein coding region (GeneMark analysis).
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Length: 978 aa
 
        Length: 978 aa Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of motif / domain search (InterProScan and SOSUI)
	Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR000330 | 5 | 23 | PF00176 | SNF2-related | 
| IPR001650 | 83 | 162 | PF00271 | DNA/RNA helicase | |
| IPR009463 | 319 | 383 | PF06465 | Protein of unknown function DUF1087 | |
| IPR009462 | 396 | 555 | PF06461 | Protein of unknown function DUF1086 | |
| IPR012957 | 754 | 927 | PF08074 | CHD | |
| HMMSmart | IPR001650 | 78 | 162 | SM00490 | DNA/RNA helicase | 
| ProfileScan | IPR001650 | 52 | 217 | PS51194 | DNA/RNA helicase | 
 Experimental conditions
 Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C  sec  °C  sec  cycles  | 
 Chromosome No. 1
 Chromosome No. 1 Experimental conditions
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | AGTAAAGGTGATTGTGTTGGC | 
| Primer_r | TGTGTGTGTGTCCTGAACTCC | 
| PCR product length | 352 bp | 
| PCR conditions | 95 °C  15 sec  66 °C  60 sec  30 cycles | 
 Japan
 || 
Other countries
Japan
 || 
Other countries