Order Kazusa clone(s) from : ![]() |
Product ID | ORK01163 |
---|---|
Accession No | AB037807 |
Description | ankyrin repeat and IBR domain containing 1 |
Clone name | fj06274 |
Vector information | |
cDNA sequence | DNA sequence (4030 bp) Predicted protein sequence (1214 aa) |
HaloTag ORF Clone |
FHC01163
![]() |
Flexi ORF Clone | FXC01163 |
Source | Human fetal brain |
Rouge ID |
mKIAA1386
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 384 bp |
---|---|
Genome contig ID | gi89161213f_91613484 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (253101 - 253150) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 91713484 | 91866583 | 20 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 171 | 183 | PR01415 | Ankyrin |
IPR002110 | 282 | 294 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 170 | 202 | PF00023 | Ankyrin |
IPR002110 | 269 | 301 | PF00023 | Ankyrin | |
IPR002867 | 527 | 603 | PF01485 | Zinc finger | |
IPR002867 | 643 | 677 | PF01485 | Zinc finger | |
IPR003903 | 975 | 992 | PF02809 | Ubiquitin interacting motif | |
HMMSmart | IPR002110 | 170 | 199 | SM00248 | Ankyrin |
IPR002110 | 269 | 298 | SM00248 | Ankyrin | |
IPR001841 | 458 | 506 | SM00184 | Zinc finger | |
IPR002867 | 527 | 603 | SM00647 | Zinc finger | |
IPR002867 | 626 | 690 | SM00647 | Zinc finger | |
IPR001841 | 644 | 768 | SM00184 | Zinc finger | |
ProfileScan | IPR002110 | 170 | 202 | PS50088 | Ankyrin |
IPR002110 | 170 | 322 | PS50297 | Ankyrin | |
IPR002110 | 269 | 301 | PS50088 | Ankyrin | |
IPR001841 | 458 | 504 | PS50089 | Zinc finger | |
IPR003903 | 976 | 995 | PS50330 | Ubiquitin interacting motif |
![]() |
Primer_f | ACAGAGGAGATGGTTCAGATG |
---|---|
Primer_r | ATCAAGCATACTCCACCTAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |