Order Kazusa clone(s) from : ![]() |
Product ID | ORK04213 |
---|---|
Accession No | AB037768 |
Description | ATPase, Ca++ transporting, type 2C, member 1 |
Clone name | fj00739 |
Vector information | |
cDNA sequence | DNA sequence (4075 bp) Predicted protein sequence (918 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1347
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 905 bp |
---|---|
Genome contig ID | gi89161205f_131995616 |
PolyA signal sequence (TATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (208175 - 208224) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 132095525 | 132203789 | 28 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001757 | 183 | 197 | PR00119 | ATPase |
IPR001757 | 347 | 361 | PR00119 | ATPase | |
IPR000695 | 509 | 527 | PR00120 | H+ transporting ATPase | |
IPR001757 | 539 | 550 | PR00119 | ATPase | |
IPR001757 | 561 | 571 | PR00119 | ATPase | |
IPR000695 | 613 | 629 | PR00120 | H+ transporting ATPase | |
IPR000695 | 641 | 657 | PR00120 | H+ transporting ATPase | |
IPR001757 | 641 | 660 | PR00119 | ATPase | |
IPR001757 | 665 | 677 | PR00119 | ATPase | |
IPR000695 | 673 | 698 | PR00120 | H+ transporting ATPase | |
HMMPfam | IPR004014 | 21 | 98 | PF00690 | ATPase |
IPR008250 | 104 | 339 | PF00122 | E1-E2 ATPase-associated region | |
IPR005834 | 343 | 664 | PF00702 | Haloacid dehalogenase-like hydrolase | |
IPR006068 | 760 | 901 | PF00689 | ATPase | |
HMMTigr | IPR006413 | 22 | 902 | TIGR01522 | Calcium-transporting P-type ATPase |
IPR001757 | 104 | 208 | TIGR01494 | ATPase | |
IPR001757 | 254 | 366 | TIGR01494 | ATPase | |
IPR001757 | 509 | 586 | TIGR01494 | ATPase | |
IPR001757 | 613 | 734 | TIGR01494 | ATPase | |
ScanRegExp | IPR001757 | 349 | 355 | PS00154 | ATPase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 75 | ISQFKNPLIMLLLASAVISVLMH | 97 | PRIMARY | 23 | 2 | 101 | DAVSITVAILIVVTVAFVQEYRS | 123 | PRIMARY | 23 | 3 | 267 | QLSFYSFGIIGIIMLVGWLLGKD | 289 | PRIMARY | 23 | 4 | 297 | SVSLAVAAIPEGLPIVVTVTLAL | 319 | PRIMARY | 23 | 5 | 772 | KNLILKILVSSIIIVCGTLFVFW | 794 | PRIMARY | 23 | 6 | 842 | MFCYAVLGSIMGQLLVIYFPPLQ | 864 | PRIMARY | 23 | 7 | 871 | SLSILDLLFLLGLTSSVCIVAEI | 893 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTGCCTTTATGGGAACACTGG |
---|---|
Primer_r | AACCAGCCAACCAACATGATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGTGGATGGCTGTTAAGTGTG |
Primer_r | TCTGCCCTTTGCTCTGGTATG |
PCR product length | 120(300) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |