Order Kazusa clone(s) from : ![]() |
Product ID | ORK00785 |
---|---|
Accession No | AB033085 |
Description | INO80 complex subunit, transcript variant 1 |
Clone name | hh15706 |
Vector information | |
cDNA sequence | DNA sequence (5979 bp) Predicted protein sequence (1561 aa) |
HaloTag ORF Clone |
FHC00785
![]() |
Flexi ORF Clone | FXC00785 |
Source | Human adult brain |
Rouge ID |
mKIAA1259
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1095 bp |
---|---|
Genome contig ID | gi51511731r_38958383 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 39058383 | 39195632 | 37 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000330 | 526 | 827 | PF00176 | SNF2-related |
IPR001650 | 1141 | 1219 | PF00271 | DNA/RNA helicase | |
HMMSmart | IPR014001 | 519 | 717 | SM00487 | DEAD-like helicases |
IPR001650 | 1136 | 1219 | SM00490 | DNA/RNA helicase | |
ProfileScan | IPR014021 | 535 | 706 | PS51192 | Helicase |
IPR001650 | 1110 | 1265 | PS51194 | DNA/RNA helicase |
![]() |
Primer_f | TGAGTCAGAAGTGGAAATGTC |
---|---|
Primer_r | TGGCTATACAGTTCACTTGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |