Order Kazusa clone(s) from : ![]() |
Product ID | ORK00777 |
---|---|
Accession No | AB033070 |
Description | ARFGEF family member 3 |
Clone name | hf00438s1 |
Vector information | |
cDNA sequence | DNA sequence (7932 bp) Predicted protein sequence (1872 aa) |
HaloTag ORF Clone |
FHC00777
![]() |
Flexi ORF Clone | FXC00777 |
Source | Human adult brain |
Rouge ID |
mKIAA1244
by Kazusa Mouse cDNA Project
|
Note | We replaced hf00438, former representative clones for KIAA1244 with hf00438s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2313 bp |
---|---|
Genome contig ID | gi89161210f_138518411 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (183220 - 183269) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 138618411 | 138701629 | 25 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR015403 | 938 | 1014 | PF09324 | Protein of unknown function DUF1981 |
HMMSmart | IPR000904 | 281 | 493 | SM00222 | SEC7-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 5 | TAPALSGPVARTIYYIAAELVRL | 27 | SECONDARY | 23 | 2 | 114 | GIEACYAAVSCVCTLLGALDELS | 136 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTGAGGAGCTGAAGGATGGGG |
---|---|
Primer_r | TGTCAAGGCTCCTCTCGTTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTGAGGAGCTGAAGGATGGGG |
Primer_r | TGTCAAGGCTCCTCTCGTTCC |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |