ROUGE |
Gene/Protein Characteristic Table for mKIAA1244 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122475 |
---|---|
mbg08203 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6576 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1568 bp Genome contig ID gi65524842r_18412485 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATCAGAGCAAGGCTCTTTGGCGTATGTGGGAAGTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAGTCCCCATTATTCAGCACATTGCCT
KIAA Alignment based on: KIAA1244 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..5008
Length: 1668 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |