Order Kazusa clone(s) from : ![]() |
Product ID | ORK00764 |
---|---|
Accession No | AB033027 |
Description | GRAM domain containing 1B, transcript variant 3 |
Clone name | fg03153 |
Vector information | |
cDNA sequence | DNA sequence (6225 bp) Predicted protein sequence (761 aa) |
HaloTag ORF Clone |
FHC00764
![]() |
Flexi ORF Clone | FXC00764 |
Source | Human fetal brain |
Rouge ID |
mKIAA1201
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3832 bp |
---|---|
Genome contig ID | gi51511727f_122836247 |
PolyA signal sequence (AATGAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence | None |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 122936247 | 123002319 | 19 | 99.2 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004182 | 119 | 186 | PF02893 | GRAM |
HMMSmart | IPR004182 | 119 | 186 | SM00568 | GRAM |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 646 | LLLVISCVICFSLVLLVILNMML | 668 | PRIMARY | 23 |
---|
![]() |
Primer_f | AACGGAGAGCACTTATTTGGC |
---|---|
Primer_r | CCTGCCACATGTTTGATCCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AACGGAGAGCACTTATTTGGC |
Primer_r | CCTGCCACATGTTTGATCCTG |
PCR product length | 189 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |