Order Kazusa clone(s) from : ![]() |
Product ID | ORK00691 |
---|---|
Accession No | AB023157 |
Description | cytoplasmic polyadenylation element binding protein 3, transcript variant 2 |
Clone name | hh04894 |
Vector information | |
cDNA sequence | DNA sequence (5715 bp) Predicted protein sequence (699 aa) |
HaloTag ORF Clone |
FHC00691
![]() |
Flexi ORF Clone | FXC00691 |
Source | Human adult brain |
Rouge ID |
mKIAA0940
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3571 bp |
---|---|
Genome contig ID | gi89161187r_93698379 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 93798379 | 93992983 | 10 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 444 | 505 | PF00076 | RNA recognition motif |
HMMSmart | IPR000504 | 443 | 515 | SM00360 | RNA recognition motif |
IPR000504 | 551 | 624 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 442 | 529 | PS50102 | RNA recognition motif |
IPR000504 | 550 | 628 | PS50102 | RNA recognition motif |
![]() |
Primer_f | GCATAAAGCTAAAGTGAAGGC |
---|---|
Primer_r | TCAGTCGCGCACAATCAACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCATAAAGCTAAAGTGAAGGC |
Primer_r | TCAGTCGCGCACAATCAACAC |
PCR product length | 153 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |