Order Kazusa clone(s) from : ![]() |
Product ID | ORK05864 |
---|---|
Accession No | AB018329 |
Description | adhesion G protein-coupled receptor L2 |
Clone name | hk05490 |
Vector information | |
cDNA sequence | DNA sequence (4345 bp) Predicted protein sequence (1021 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0786
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000832 | 411 | 435 | PR00249 | GPCR |
IPR003924 | 436 | 451 | PR01444 | Latrophilin receptor | |
IPR000832 | 474 | 497 | PR00249 | GPCR | |
IPR000832 | 554 | 579 | PR00249 | GPCR | |
IPR000832 | 628 | 649 | PR00249 | GPCR | |
IPR003924 | 650 | 662 | PR01444 | Latrophilin receptor | |
HMMPfam | IPR001879 | 28 | 88 | PF02793 | Hormone receptor |
IPR000203 | 346 | 393 | PF01825 | GPS | |
IPR000832 | 406 | 653 | PF00002 | GPCR | |
IPR003334 | 663 | 1021 | PF02354 | Latrophilin | |
HMMSmart | IPR001879 | 27 | 92 | SM00008 | Hormone receptor |
IPR000203 | 346 | 398 | SM00303 | GPS | |
ProfileScan | IPR001879 | 30 | 87 | PS50227 | Hormone receptor |
IPR000203 | 347 | 398 | PS50221 | GPS | |
IPR000832 | 409 | 650 | PS50261 | GPCR | |
ScanRegExp | IPR000832 | 638 | 653 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 409 | LTVITWVGIVISLVCLAICIFTF | 431 | PRIMARY | 23 | 2 | 443 | TIHKNLCINLFIAEFIFLIGIDK | 465 | SECONDARY | 23 | 3 | 477 | GLLHFFFLAAFAWMCLEGVQLYL | 499 | PRIMARY | 23 | 4 | 515 | YYVAGYLFPATVVGVSAAID | 534 | SECONDARY | 20 | 5 | 555 | SFIGPVTFIILLNIIFLVITLCK | 577 | PRIMARY | 23 | 6 | 596 | KSWVLGAFALLCLLGLTWSFGLL | 618 | PRIMARY | 23 | 7 | 627 | MAYLFTIFNAFQGVFIFIFHCAL | 649 | PRIMARY | 23 |
---|
![]() |
Primer_f | CTCTTTGAAGCCAGTTATGTC |
---|---|
Primer_r | AAGTTTGTGAGAAGTGCCCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |