Order Kazusa clone(s) from : ![]() |
Product ID | ORK01989 |
---|---|
Accession No | AB014575 |
Description | DAZ interacting zinc finger protein 3 |
Clone name | hk02566 |
Vector information | |
cDNA sequence | DNA sequence (4246 bp) Predicted protein sequence (1217 aa) |
HaloTag ORF Clone |
FHC01989
![]() |
Flexi ORF Clone | FXC01989 |
Source | Human adult brain |
Rouge ID |
mKIAA0675
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 490 bp |
---|---|
Genome contig ID | gi89161205f_109704388 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (188538 - 188587) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 109804388 | 109892924 | 32 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001841 | 1157 | 1196 | PF00097 | Zinc finger |
HMMSmart | IPR001841 | 1157 | 1196 | SM00184 | Zinc finger |
ProfileScan | IPR001841 | 1157 | 1197 | PS50089 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 136 | HQINIGYYLTLLFLYGVALTE | 156 | PRIMARY | 21 |
---|
![]() |
---|
![]() |
Primer_f | CAGACTCCACGTTTTGCTACC |
---|---|
Primer_r | TACACCACTCAAACAAGCAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGACTCCACGTTTTGCTACC |
Primer_r | TACACCACTCAAACAAGCAGC |
PCR product length | 139 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |