ROUGE |
Gene/Protein Characteristic Table for mKIAA0675 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122344 |
---|---|
mbg06414 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5833 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3436 bp Genome contig ID gi65546577r_47666341 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATTTTTATGTGGAAAATAAAAATATTTCTGAATTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATATCTATTTCTTTATGTATTCATCTTAAATGTGTCCAAACAAACTTTA
KIAA Alignment based on: KIAA0675 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1600..2397
Length: 265 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |