Order Kazusa clone(s) from : ![]() |
Product ID | ORK01166 |
---|---|
Accession No | AB040881 |
Description | kinesin family member 1B, transcript variant 2 |
Clone name | fh12320y1 |
Vector information | |
cDNA sequence | DNA sequence (5883 bp) Predicted protein sequence (1179 aa) |
HaloTag ORF Clone |
FHC01166
![]() |
Flexi ORF Clone | FXC01166 |
Source | Human fetal brain |
Note | We replaced fh12320, former representative clones for KIAA1448 with fh12320y1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2110 bp |
---|---|
Genome contig ID | gi89161185f_10113409 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (175995 - 176044) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 10213409 | 10289402 | 21 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 114 | 135 | PR00380 | Kinesin |
IPR001752 | 234 | 251 | PR00380 | Kinesin | |
IPR001752 | 269 | 287 | PR00380 | Kinesin | |
IPR001752 | 324 | 345 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 37 | 375 | PF00225 | Kinesin |
IPR000253 | 536 | 607 | PF00498 | Forkhead-associated | |
HMMSmart | IPR001752 | 29 | 382 | SM00129 | Kinesin |
IPR000253 | 535 | 592 | SM00240 | Forkhead-associated | |
ProfileScan | IPR001752 | 28 | 299 | PS50067 | Kinesin |
IPR000253 | 536 | 592 | PS50006 | Forkhead-associated | |
ScanRegExp | IPR001752 | 268 | 279 | PS00411 | Kinesin |
![]() |
Primer_f | TACATCGTTCCTCATCTCTTG |
---|---|
Primer_r | CCTTGAATGCTAACTGCTATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |