|
Order Kazusa clone(s) from : |
| Product ID | ORK07454 |
|---|---|
| Accession No | AB011102 |
| Description | zinc finger protein 292 |
| Clone name | hg02934 |
| Vector information | |
| cDNA sequence | DNA sequence (6578 bp) Predicted protein sequence (1563 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0530
by Kazusa Mouse cDNA Project
|
Length: 6578 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1563 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 787 | 812 | PF00096 | Zinc finger |
| IPR007087 | 1096 | 1121 | PF00096 | Zinc finger | |
| HMMSmart | IPR015880 | 215 | 235 | SM00355 | Zinc finger |
| IPR015880 | 742 | 767 | SM00355 | Zinc finger | |
| IPR015880 | 787 | 812 | SM00355 | Zinc finger | |
| IPR015880 | 954 | 979 | SM00355 | Zinc finger | |
| IPR015880 | 1012 | 1037 | SM00355 | Zinc finger | |
| IPR015880 | 1056 | 1081 | SM00355 | Zinc finger | |
| IPR015880 | 1096 | 1121 | SM00355 | Zinc finger | |
| IPR015880 | 1226 | 1250 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 215 | 242 | PS50157 | Zinc finger |
| IPR007087 | 787 | 812 | PS50157 | Zinc finger | |
| IPR007087 | 954 | 984 | PS50157 | Zinc finger | |
| IPR007087 | 1012 | 1042 | PS50157 | Zinc finger | |
| IPR007087 | 1096 | 1126 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 789 | 813 | PS00028 | Zinc finger |
| IPR007087 | 956 | 979 | PS00028 | Zinc finger | |
| IPR007087 | 1014 | 1037 | PS00028 | Zinc finger | |
| IPR007087 | 1058 | 1081 | PS00028 | Zinc finger | |
| IPR007087 | 1098 | 1121 | PS00028 | Zinc finger | |
| IPR007087 | 1228 | 1250 | PS00028 | Zinc finger |
RT-PCR
|
|---|
Experimental conditions| Primer_f | GTAGAGGTTATTCCAGGAGAG |
|---|---|
| Primer_r | TCAGAGTACCAGCGATTTCAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 6
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GTAGAGGTTATTCCAGGAGAG |
| Primer_r | TCAGAGTACCAGCGATTTCAG |
| PCR product length | 286 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |