Order Kazusa clone(s) from : ![]() |
Product ID | ORK00542 |
---|---|
Accession No | AB007932 |
Description | plexin A2 |
Clone name | hg00942 |
Vector information | |
cDNA sequence | DNA sequence (6263 bp) Predicted protein sequence (1963 aa) |
HaloTag ORF Clone |
FHC00542
![]() |
Flexi ORF Clone | FXC00542 |
Source | Human adult brain |
Rouge ID |
mKIAA0463
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 119 | 560 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 579 | 629 | PF01437 | Plexin | |
IPR002165 | 724 | 771 | PF01437 | Plexin | |
IPR002165 | 872 | 925 | PF01437 | Plexin | |
IPR002909 | 927 | 1020 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1023 | 1106 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1110 | 1208 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1212 | 1297 | PF01833 | Cell surface receptor IPT/TIG | |
IPR013548 | 1379 | 1933 | PF08337 | Plexin cytoplasmic region | |
HMMSmart | IPR001627 | 119 | 561 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 579 | 629 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 724 | 771 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 872 | 925 | SM00423 | Plexin/semaphorin/integrin | |
IPR002909 | 926 | 1021 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1022 | 1107 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1109 | 1209 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1211 | 1306 | SM00429 | Cell surface receptor IPT/TIG | |
ProfileScan | IPR001627 | 94 | 577 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 81 | EVDSRSVVLLSVVWVLLAPPAAG | 103 | PRIMARY | 23 | 2 | 128 | TGAVYVGAINRVYKLTGNLTIQV | 150 | SECONDARY | 23 | 3 | 1307 | AIVSIAAGGSLLLIIVIIVLIA | 1328 | PRIMARY | 22 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAAAGCAGCAGTCACAGAGG |
Primer_r | TTCGTCATAGCCAGTTCCAGC |
PCR product length | 149 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |