|
Order Kazusa clone(s) from : |
| Product ID | ORK07340 |
|---|---|
| Accession No | AB007922 |
| Description | vacuolar protein sorting 13 homolog D (S. cerevisiae) |
| Clone name | ff02431 |
| Vector information | |
| cDNA sequence | DNA sequence (10969 bp) Predicted protein sequence (3209 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA0453
by Kazusa Mouse cDNA Project
|
| Note | We replaced hg00489, former representative clones for KIAA0453 with ff02431. (2003/8/28) |
Length: 10969 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1337 bp |
|---|---|
| Genome contig ID | gi89161185f_12159765 |
| PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (333239 - 333288) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 12259765 | 12493002 | 52 | 99.9 | Perfect prediction |
Length: 3209 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000449 | 1459 | 1498 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B |
| IPR009543 | 2084 | 2394 | PF06650 | Vacuolar protein sorting-associated protein | |
| HMMSmart | IPR000449 | 1460 | 1497 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B |
| ProfileScan | IPR000449 | 1455 | 1498 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B |
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CAAGGCATTTTATTCCACAGG |
| Primer_r | TTTGTAAGTATGATCTGGGCC |
| PCR product length | 173 bp |
| PCR conditions | 95 °C 15 sec 60 °C 60 sec 30 cycles |