KIAA1749

Product ID	ORK04545
Accession No	AB051536
Description	cingulin-like 1
Clone name	pj02119y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6373 bp) Predicted protein sequence (1047 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1749 by Kazusa Mouse cDNA Project
Note	We replaced pj02119, former representative clones for KIAA1749 with pj02119y1. (2003/4/2)

Length: 6373 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3227 bp
Genome contig ID	gi51511731f_55418253
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGATTTCCTTTCAATAAACGCTGTCACCCAATGGG
Flanking genome sequence (211954 - 212003)	----+--------+--------+--------+--------+----* AATTTTGACTCTCCTGTGATTGTGACTTCTTTGTTTTCTCCAGAGCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	55518253	55630205	18	99.3	Perfect prediction

Length: 1047 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q0VF96	99.9	Cingulin-like p...	Homo sapiens
AAH93827	99.8	Cingulin-like 1...	Homo sapiens
XP_510437	99.2	cingulin-like 1...	Pan troglodytes
AAT37906	99.0	paracingulin [H...	Homo sapiens
XP_001092704	97.6	similar to cing...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037740	2.2e-32	33.2	KIAA1319
AB020673	3.8e-14	26.0	KIAA0866
AB111886	1.2e-10	24.6	KIAA2034
AB023217	3.6e-09	24.7	KIAA1000
AB040945	4.1e-08	24.0	KIAA1512

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002928	809	1003	PF01576	Myosin tail

Primer_f	CACATTCTCCAAGGACAGCAC
Primer_r	TAACACTGAGGAGCTGGCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-