Order Kazusa clone(s) from : ![]() |
Product ID | ORK01972 |
---|---|
Accession No | AB002372 |
Description | syntaphilin |
Clone name | hh00327 |
Vector information | |
cDNA sequence | DNA sequence (5530 bp) Predicted protein sequence (584 aa) |
HaloTag ORF Clone |
FHC01972
![]() |
Flexi ORF Clone | FXC01972 |
Source | Human adult brain |
Rouge ID |
mKIAA0374
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3271 bp |
---|---|
Genome contig ID | gi51511747f_1094999 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (142972 - 143021) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 1194999 | 1237969 | 7 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 10 | WVVGTCAPALFNSLVEAAVVCQA | 32 | PRIMARY | 23 | 2 | 514 | HYIVDLLAVVVPAVPTVAWLCR | 535 | PRIMARY | 22 |
---|
![]() |
---|
Primer_f | GGATGGCCTAATATGGGAATG |
---|---|
Primer_r | TCTTACAGCACTTTGGGGAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGATGGCCTAATATGGGAATG |
Primer_r | TCTTACAGCACTTTGGGGAGG |
PCR product length | 151 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |