Order Kazusa clone(s) from : ![]() |
Product ID | ORK00054 |
---|---|
Accession No | AB002334 |
Description | GRIP and coiled-coil domain containing 2 |
Clone name | hg01120 |
Vector information | |
cDNA sequence | DNA sequence (6773 bp) Predicted protein sequence (1635 aa) |
HaloTag ORF Clone |
FHC00054
![]() |
Flexi ORF Clone | FXC00054 |
Source | Human adult brain |
Rouge ID |
mKIAA0336
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1768 bp |
---|---|
Genome contig ID | gi89161199f_108332128 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (160159 - 160208) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 108432128 | 108492285 | 22 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | CATTACACTTCCTCTCATTGC |
---|---|
Primer_r | TAGTCTCTGCTTACGAATGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATTACACTTCCTCTCATTGC |
Primer_r | TAGTCTCTGCTTACGAATGTC |
PCR product length | 112 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |