Order Kazusa clone(s) from : ![]() |
Product ID | ORK00437 |
---|---|
Accession No | D79983 |
Description | ring finger protein 144A |
Clone name | ha02800 |
Vector information | |
cDNA sequence | DNA sequence (5559 bp) Predicted protein sequence (326 aa) |
HaloTag ORF Clone |
FHC00437
![]() |
Flexi ORF Clone | FXC00437 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0161
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 4332 bp |
---|---|
Genome contig ID | gi89161199f_6875126 |
PolyA signal sequence (AATACA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (226551 - 226600) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 6975068 | 7101675 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001841 | 54 | 100 | PF00097 | Zinc finger |
IPR002867 | 125 | 190 | PF01485 | Zinc finger | |
HMMSmart | IPR002867 | 125 | 190 | SM00647 | Zinc finger |
IPR002867 | 202 | 266 | SM00647 | Zinc finger | |
ProfileScan | IPR001841 | 54 | 100 | PS50089 | Zinc finger |
ScanRegExp | IPR001841 | 240 | 249 | PS00518 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 289 | AGFGLLLLVASPFLLLATPFVLC | 311 | PRIMARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | CCATGCCTGCCCTTTCTTTCC |
Primer_r | TTTGTTTCACCACCACTTGTC |
PCR product length | 129 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |