Order Kazusa clone(s) from : ![]() |
Product ID | ORK00422 |
---|---|
Accession No | D50927 |
Description | tousled-like kinase 1, transcript variant 1 |
Clone name | ha02915s1 |
Vector information | |
cDNA sequence | DNA sequence (4122 bp) Predicted protein sequence (801 aa) |
HaloTag ORF Clone |
FHC00422
![]() |
Flexi ORF Clone | FXC00422 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0137
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02915, former representative clones for KIAA0137 with ha02915s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1716 bp |
---|---|
Genome contig ID | gi89161199r_171456816 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 171556816 | 171725289 | 21 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 502 | 767 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 491 | 769 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 491 | 767 | SM00219 | Tyrosine protein kinase |
IPR002290 | 491 | 769 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 491 | 769 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 497 | 520 | PS00107 | Protein kinase |
IPR008271 | 617 | 629 | PS00108 | Serine/threonine protein kinase |
Panel name | Stanford G3 |
---|---|
Primer_f | ATCCCCTACACCCCCTTCTTC |
Primer_r | GTCATCCTTCCTTCACTGCTC |
PCR product length | 277 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |