Gene/Protein Characteristic Table for FLJ00343 |
Description |
| Product ID: | ORK03392 |
|---|---|
| Accession No.: | AK090427 |
| Alias Name: | |
| Clone Name: | sf00012 [Vector Info] |
| Source: | Human spleen |
| Features of the cloned DNA sequence | Description |
|---|
Length: 8278
|
cloned DNA seq.
| |
Length of 3'UTR 320 bp Genome contig ID gi29826146r_151062600 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CCAGCCAAGAGGAATAAAGTTTTGCTTCCATTCTCFlanking genome sequence None
| Features of the predicted protein sequence | Description |
|---|
Length: 2651
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.