Gene/Protein Characteristic Table for FLJ00119 |
Description |
Product ID: | ORK05084 |
---|---|
Accession No.: | AK074048 |
Alias Name: | |
Clone Name: | as00119 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 4689
![]() |
cloned DNA seq.
| |
Length of 3'UTR 320 bp Genome contig ID gi29826146r_151062600 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CCAGCCAAGAGGAATAAAGTTTTGCTTCCATTCTCFlanking genome sequence None
Features of the predicted protein sequence | Description |
---|
Length: 1455
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.