Gene/Protein Characteristic Table for FLJ00267

Description

Product ID:	ORK04158
Accession No.:	AK160366
Alias Name:
Clone Name:	sj04085 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4393
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 766 bp

Genome contig ID gi29824572r_157694613
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GAAGGTCAATGTCTCAGAATAAAAGCTGTATTTTT
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 1110

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD18709	100.0	FLJ00267 protei...	Homo sapiens
BAG72739	100.0	Rho GTPase acti...	synthetic construct
EAW52673	99.9	Rho GTPase acti...	Homo sapiens
NP_001020769	99.8	Rho GTPase acti...	Homo sapiens
Q7Z6I6	99.7	Rho GTPase-acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018255	4.2e-25	39.5	KIAA0712
AB033030	2.2e-24	30.3	KIAA1204
AB040934	6.7e-07	32.3	KIAA1501
AB014572	9.9e-07	26.6	KIAA0672
D50921	1.7e-05	24.9	KIAA0131

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 43 196 PF00620 RhoGAP domain

HMMSmart IPR000198 40 221 SM00324 RhoGAP domain

ProfileScan IPR000198 43 188 PS50238 RhoGAP domain

NULL 659 910 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	43	196	PF00620	RhoGAP domain
HMMSmart	IPR000198	40	221	SM00324	RhoGAP domain
ProfileScan	IPR000198	43	188	PS50238	RhoGAP domain
NULL	659	910	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	766 bp
Genome contig ID	gi29824572r_157694613
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GAAGGTCAATGTCTCAGAATAAAAGCTGTATTTTT
Flanking genome sequence	None