Gene/Protein Characteristic Table for FLJ00267 |
Description |
Product ID: | ORK04158 |
---|---|
Accession No.: | AK160366 |
Alias Name: | |
Clone Name: | sj04085 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 4393
cloned DNA seq.
| |
Length of 3'UTR 766 bp Genome contig ID gi29824572r_157694613 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GAAGGTCAATGTCTCAGAATAAAAGCTGTATTTTTFlanking genome sequence None
Features of the predicted protein sequence | Description |
---|
Length: 1110
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.