Gene/Protein Characteristic Table for FLJ00201

Description

Product ID:	ORK01040
Accession No.:	AK074129
Alias Name:
Clone Name:	sj04110 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4443
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2324 bp

Genome contig ID gi29824572r_35887455
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CTGTATTGACACATCCTCAATAAAACCTGTTGTAT
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 705

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB84955	8.3e-200	100.0	FLJ00201 protei...	Homo sapiens
P25067	2.7e-199	100.0	Collagen alpha-...	Homo sapiens
XP_001158595	6.1e-198	99.0	similar to FLJ0...	Pan troglodytes
XP_001102808	3.2e-197	98.9	similar to coll...	Macaca mulatta
XP_001499169	1.8e-192	95.9	similar to coll...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058773	2.3e-23	42.9	KIAA1870
AB040943	0.00023	41.3	KIAA1510
AB067474	0.00045	28.9	KIAA1887
AB002304	0.00077	28.9	KIAA0306

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001073 587 613 PR00007 Complement C1q protein

IPR001073 614 633 PR00007 Complement C1q protein

IPR001073 659 680 PR00007 Complement C1q protein

IPR001073 693 703 PR00007 Complement C1q protein

HMMPfam IPR008160 111 169 PF01391 Collagen triple helix repeat

IPR008160 175 233 PF01391 Collagen triple helix repeat

IPR008160 239 297 PF01391 Collagen triple helix repeat

IPR008160 298 356 PF01391 Collagen triple helix repeat

IPR008160 360 419 PF01391 Collagen triple helix repeat

IPR008160 420 479 PF01391 Collagen triple helix repeat

IPR008160 480 538 PF01391 Collagen triple helix repeat

IPR001073 578 702 PF00386 Complement C1q protein

HMMSmart IPR001073 570 705 SM00110 Complement C1q protein

ProfileScan NULL 23 569 PS50315 NULL

IPR000694 48 535 PS50099 Proline-rich region

IPR008160 78 536 PS50288 Collagen triple helix repeat

ScanRegExp IPR001073 596 626 PS01113 Complement C1q protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 4 25 LGTLTPLSSLLLLLLVLVLGCG

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001073	587	613	PR00007	Complement C1q protein
IPR001073	614	633	PR00007	Complement C1q protein
IPR001073	659	680	PR00007	Complement C1q protein
IPR001073	693	703	PR00007	Complement C1q protein
HMMPfam	IPR008160	111	169	PF01391	Collagen triple helix repeat
IPR008160	175	233	PF01391	Collagen triple helix repeat
IPR008160	239	297	PF01391	Collagen triple helix repeat
IPR008160	298	356	PF01391	Collagen triple helix repeat
IPR008160	360	419	PF01391	Collagen triple helix repeat
IPR008160	420	479	PF01391	Collagen triple helix repeat
IPR008160	480	538	PF01391	Collagen triple helix repeat
IPR001073	578	702	PF00386	Complement C1q protein
HMMSmart	IPR001073	570	705	SM00110	Complement C1q protein
ProfileScan	NULL	23	569	PS50315	NULL
IPR000694	48	535	PS50099	Proline-rich region
IPR008160	78	536	PS50288	Collagen triple helix repeat
ScanRegExp	IPR001073	596	626	PS01113	Complement C1q protein

Method	From	To	amino acid sequence
SOSUI	4	25	LGTLTPLSSLLLLLLVLVLGCG

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2324 bp
Genome contig ID	gi29824572r_35887455
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CTGTATTGACACATCCTCAATAAAACCTGTTGTAT
Flanking genome sequence	None