HUGE

Gene/Protein Characteristic Table for KIAA1510

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040943
Description :	Collagen alpha-1(XX) chain precursor.
HUGO Gene Name :	collagen, type XX, alpha 1 (COL20A1)
Clone Name :	fg02934 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 8029 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 4079 bp

Genome contig ID gi51511747f_61307810
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTAAATAGTAGAAAATAAACCCTGAAGCAGTGTG
Flanking genome sequence
(128785 - 128834)
----+----*----+----*----+----*----+----*----+----*
CATTCATTAGTACTGTGTTTGCCTGTATTTAATTAAAACCTGATTGCCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 61407810 61436593 32 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1140 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI95066	99.9	collagen, type ...	Homo sapiens
CAI95065	98.6	collagen, type ...	Homo sapiens
AAH43183	98.4	Collagen, type ...	Homo sapiens
XP_001148451	96.8	hypothetical pr...	Pan troglodytes
Q9P218	97.2	Collagen alpha-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058773	2.3e-10	40.6	KIAA1870
AB075863	5.6e-05	51.7	KIAA1983

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR008161 940 957 PD000007 Collagen helix repeat

IPR008161 991 1014 PD000007 Collagen helix repeat

FPrintScan IPR002035 28 45 PR00453 von Willebrand factor

IPR002035 67 81 PR00453 von Willebrand factor

IPR002035 133 141 PR00453 von Willebrand factor

HMMPfam IPR002035 29 201 PF00092 von Willebrand factor

IPR003961 227 310 PF00041 Fibronectin

IPR003961 317 395 PF00041 Fibronectin

IPR003961 407 489 PF00041 Fibronectin

IPR003961 497 577 PF00041 Fibronectin

IPR003961 590 670 PF00041 Fibronectin

IPR008160 921 978 PF01391 Collagen triple helix repeat

IPR008160 985 1041 PF01391 Collagen triple helix repeat

HMMSmart IPR002035 27 206 SM00327 von Willebrand factor

IPR003961 227 307 SM00060 Fibronectin

IPR003961 316 396 SM00060 Fibronectin

IPR003961 407 486 SM00060 Fibronectin

IPR003961 497 576 SM00060 Fibronectin

IPR003961 591 670 SM00060 Fibronectin

IPR003129 692 887 SM00210 Laminin G

ProfileScan IPR002035 29 204 PS50234 von Willebrand factor

IPR003961 228 314 PS50853 Fibronectin

IPR003961 316 404 PS50853 Fibronectin

IPR003961 406 494 PS50853 Fibronectin

IPR003961 498 586 PS50853 Fibronectin

IPR003961 590 679 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	940	957	PD000007	Collagen helix repeat
IPR008161	991	1014	PD000007	Collagen helix repeat
FPrintScan	IPR002035	28	45	PR00453	von Willebrand factor
IPR002035	67	81	PR00453	von Willebrand factor
IPR002035	133	141	PR00453	von Willebrand factor
HMMPfam	IPR002035	29	201	PF00092	von Willebrand factor
IPR003961	227	310	PF00041	Fibronectin
IPR003961	317	395	PF00041	Fibronectin
IPR003961	407	489	PF00041	Fibronectin
IPR003961	497	577	PF00041	Fibronectin
IPR003961	590	670	PF00041	Fibronectin
IPR008160	921	978	PF01391	Collagen triple helix repeat
IPR008160	985	1041	PF01391	Collagen triple helix repeat
HMMSmart	IPR002035	27	206	SM00327	von Willebrand factor
IPR003961	227	307	SM00060	Fibronectin
IPR003961	316	396	SM00060	Fibronectin
IPR003961	407	486	SM00060	Fibronectin
IPR003961	497	576	SM00060	Fibronectin
IPR003961	591	670	SM00060	Fibronectin
IPR003129	692	887	SM00210	Laminin G
ProfileScan	IPR002035	29	204	PS50234	von Willebrand factor
IPR003961	228	314	PS50853	Fibronectin
IPR003961	316	404	PS50853	Fibronectin
IPR003961	406	494	PS50853	Fibronectin
IPR003961	498	586	PS50853	Fibronectin
IPR003961	590	679	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGCCAGCCTCTTCATCTACC

Primer_r
: TCAAGTCCAAATGTTCCACGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGCCAGCCTCTTCATCTACC
Primer_r	: TCAAGTCCAAATGTTCCACGC
PCR product length	: 149 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	4079 bp
Genome contig ID	gi51511747f_61307810
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTAAATAGTAGAAAATAAACCCTGAAGCAGTGTG
Flanking genome sequence (128785 - 128834)	----+--------+--------+--------+--------+----* CATTCATTAGTACTGTGTTTGCCTGTATTTAATTAAAACCTGATTGCCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	61407810	61436593	32	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1510

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information