HUGE

Gene/Protein Characteristic Table for KIAA1887

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05943
Accession No. :	AB067474
Description :	Methyl-CpG-binding domain protein 6.
HUGO Gene Name :	methyl-CpG binding domain protein 6 (MBD6)
Clone Name :	fk02232 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3819 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 914 bp

Genome contig ID gi89161190f_56104767
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAATTTAACAGATGAGAATATTTTGAAACTCTG
Flanking genome sequence
(105433 - 105482)
----+----*----+----*----+----*----+----*----+----*
GCTCTGGCTCTGTACTCATTTTTTATTTAGTTCTTTGGTAAGAACAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 56204765 56210198 10 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96DN6	100.0	Methyl-CpG-bind...	Homo sapiens
AAH65530	99.9	Methyl-CpG bind...	Homo sapiens
BAB71176	99.9	unnamed protein...	Homo sapiens
XP_849726	95.2	similar to meth...	Canis lupus fam...
XP_001917827	94.4	similar to Meth...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040894	1.6e-05	28.1	KIAA1461
AB051468	0.00011	26.6	KIAA1681
AB051547	0.00015	29.8	KIAA1760
AB002307	0.0002	28.4	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTCTTCAGCCACTATGCACC

Primer_r
: TGAGAGGGACGAAGTGATGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	914 bp
Genome contig ID	gi89161190f_56104767
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAATTTAACAGATGAGAATATTTTGAAACTCTG
Flanking genome sequence (105433 - 105482)	----+--------+--------+--------+--------+----* GCTCTGGCTCTGTACTCATTTTTTATTTAGTTCTTTGGTAAGAACAGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	56204765	56210198	10	99.9	Perfect prediction

Primer_f	: TGTCTTCAGCCACTATGCACC
Primer_r	: TGAGAGGGACGAAGTGATGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1887

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information