Gene/Protein Characteristic Table for FLJ00156 |
Description |
| Product ID: | ORK05099 |
|---|---|
| Accession No.: | AK074085 |
| Alias Name: | |
| Clone Name: | sh06477 [Vector Info] |
| Source: | Human spleen |
| Features of the cloned DNA sequence | Description |
|---|
Length: 5860
|
cloned DNA seq.
| |
Length of 3'UTR 194 bp Genome contig ID gi89161187f_49566638 PolyA signal sequence
(ATTAAA,-25)
TCTTTATTTTATTAAAGCAACTATGTTTTAAATGCFlanking genome sequence
(294370 - 294419)
AGAAGGGCTCTTCAGTTTTAAACTGCCACTCTATTCCACTTACCATGCTG
| Features of the predicted protein sequence | Description |
|---|
Length: 1887
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
