HUGE

Gene/Protein Characteristic Table for KIAA0540

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06104
Accession No. :	AB011112
Description :	SQFE253.
HUGO Gene Name :	neurobeachin-like 2 (NBEAL2)
Clone Name :	pg00116 [Vector Info]
Flexi ORF Clone :	pF1KA0540
Source :	Human brain (hippocampus)
Note :	We replaced hg04185, former representative clones for KIAA0540 with pg00116. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6364 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 236 bp

Genome contig ID gi89161205f_46911815
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCGCCCTGAGGGCCAGCACTGGCGTCTGCGGCCGC
Flanking genome sequence
(114237 - 114286)
----+----*----+----*----+----*----+----*----+----*
AGCAGCACTTTTTGCACAGTCTGGGGCGGGGTTCCCCGGCTTCCAAGTCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 47011815 47026050 40 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW64803	100.0	hCG15426, isofo...	Homo sapiens
BAC85154	91.7	FLJ00341 protei...	Homo sapiens
XP_001916603	85.3	neurobeachin-li...	Equus caballus
XP_236649	82.3	similar to neur...	Rattus norvegicus
Q6ZQA0	81.3	Neurobeachin-li...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046764	2e-55	33.7	KIAA1544
AB023210	2.6e-49	36.2	KIAA0993
AB046827	2.8e-46	30.0	KIAA1607

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000409 1352 1632 PF02138 Beige/BEACH

IPR001680 1779 1817 PF00400 WD40 repeat

IPR001680 1830 1868 PF00400 WD40 repeat

HMMSmart IPR001680 1730 1775 SM00320 WD40 repeat

IPR001680 1778 1817 SM00320 WD40 repeat

IPR001680 1829 1868 SM00320 WD40 repeat

ProfileScan IPR000409 1340 1632 PS50197 Beige/BEACH

IPR001680 1742 1877 PS50294 WD40 repeat

IPR001680 1785 1818 PS50082 WD40 repeat

IPR001680 1836 1877 PS50082 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000409	1352	1632	PF02138	Beige/BEACH
IPR001680	1779	1817	PF00400	WD40 repeat
IPR001680	1830	1868	PF00400	WD40 repeat
HMMSmart	IPR001680	1730	1775	SM00320	WD40 repeat
IPR001680	1778	1817	SM00320	WD40 repeat
IPR001680	1829	1868	SM00320	WD40 repeat
ProfileScan	IPR000409	1340	1632	PS50197	Beige/BEACH
IPR001680	1742	1877	PS50294	WD40 repeat
IPR001680	1785	1818	PS50082	WD40 repeat
IPR001680	1836	1877	PS50082	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCACATCCTCCAACTAAACAC

Primer_r
: AGTAGGGTTGTATTCCGTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCACATCCTCCAACTAAACAC
Primer_r	: AGTAGGGTTGTATTCCGTCTC
PCR product length	: 247 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	236 bp
Genome contig ID	gi89161205f_46911815
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGCCCTGAGGGCCAGCACTGGCGTCTGCGGCCGC
Flanking genome sequence (114237 - 114286)	----+--------+--------+--------+--------+----* AGCAGCACTTTTTGCACAGTCTGGGGCGGGGTTCCCCGGCTTCCAAGTCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	47011815	47026050	40	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0540

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information