KIAA1249

Product ID	ORK04720
Accession No	AB033075
Description	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Clone name	hh04184
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5475 bp) Predicted protein sequence (949 aa)
Source	Human adult brain
Rouge ID	mKIAA1249 by Kazusa Mouse cDNA Project

Length: 5475 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2624 bp
Genome contig ID	gi51511724r_131033535
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATTGCTTTTAAATAAACATATTCTCAGTTGATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTCTGAAATCAGGCCATTTTGTGAGTTGTTCACTACCCTGCTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	131133535	131262290	23	99.9	Perfect prediction

Length: 949 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001155932	99.9	development and...	Pan troglodytes
CAD97831	99.7	hypothetical pr...	Homo sapiens
EAW92131	99.7	development and...	Homo sapiens
EAW92130	99.7	development and...	Homo sapiens
XP_519959	99.6	development and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007860	1.2e-52	53.0	KIAA0400
AB075855	2e-05	31.4	KIAA1975
D26069	2.8e-05	30.1	KIAA0041
AB029022	2.8e-05	31.1	KIAA1099
D79989	0.00013	29.7	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	892	944	PD000066	Src homology-3
FPrintScan	IPR001164	271	290	PR00405	Arf GTPase activating protein
	IPR001164	290	307	PR00405	Arf GTPase activating protein
	IPR001164	311	332	PR00405	Arf GTPase activating protein
	IPR000108	791	808	PR00499	Neutrophil cytosol factor 2
	IPR001452	890	900	PR00452	Src homology-3
	IPR000108	892	912	PR00499	Neutrophil cytosol factor 2
	IPR001452	904	919	PR00452	Src homology-3
	IPR000108	912	928	PR00499	Neutrophil cytosol factor 2
	IPR001452	921	930	PR00452	Src homology-3
	IPR001452	935	947	PR00452	Src homology-3
HMMPfam	IPR001849	145	236	PF00169	Pleckstrin-like
	IPR001164	259	382	PF01412	Arf GTPase activating protein
	IPR002110	420	455	PF00023	Ankyrin
	IPR002110	456	488	PF00023	Ankyrin
	IPR001452	890	947	PF00018	Src homology-3
HMMSmart	IPR001849	145	238	SM00233	Pleckstrin-like
	IPR001164	259	382	SM00105	Arf GTPase activating protein
	IPR002110	420	452	SM00248	Ankyrin
	IPR002110	456	485	SM00248	Ankyrin
	IPR001452	890	948	SM00326	Src homology-3
ProfileScan	IPR001849	144	236	PS50003	Pleckstrin-like
	IPR001164	259	372	PS50115	Arf GTPase activating protein
	IPR002110	420	455	PS50088	Ankyrin
	IPR002110	420	497	PS50297	Ankyrin
	IPR001452	887	949	PS50002	Src homology-3

Primer_f	CGAGTGAAGACCATTTATGAC
Primer_r	TTGCTAGTCAGACAGGATATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCAAACAGAGCATGAGGAACC
Primer_r	GTGTAAATGAATGACCGGGAC
PCR product length	138 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles