ROUGE |
Gene/Protein Characteristic Table for mKIAA4188 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220533 |
---|---|
Transducin-like enhancer protein 2. | |
mbh00640 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3626 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 134 bp Genome contig ID gi65524842f_81611022 PolyA signal sequence
(AATATA,-17) +----*----+----*----+----*----+----
GGGCTGGGGCACTGGGGAAATATAACACATTTATCFlanking genome sequence
(116132 - 116181) ----+----*----+----*----+----*----+----*----+----*
AACTTGCTTTCTTTCTGTGTGTGTGTGAAGCGTACAGGTGAGGGACCCGA
Features of the protein sequence |
Description | |
Coding region: 2284..3489
Length: 402 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |