ROUGE

Gene/Protein Characteristic Table for mKIAA0606

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093251
Description :
Clone Name :	mbg00108 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4862 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 904 bp

Genome contig ID gi65488608f_106014214
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TAATTTTTGTTATAATAAATATGAAATTTACAAGT
Flanking genome sequence
(321136 - 321185)
----+----*----+----*----+----*----+----*----+----*
ACTGAATCTATCTGCTTTTGTCTCAGCATCCAGGTGTGTCTCACAGCCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0606 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0606	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3958
Length: 1318 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8CHE4	100.0	PH domain leuci...	Mus musculus
EDL39865	99.5	mCG8997 [Mus mu...	Mus musculus
XP_001475889	99.5	similar to PH d...	Mus musculus
EDL91741	96.2	PH domain and l...	Rattus norvegicus
Q9WTR8	96.2	PH domain leuci...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC049775	2e-08	27.0	mKIAA0862
AK220166	3.5e-07	26.1	mKIAA4018
AK122211	4e-05	29.1	mKIAA0147
AK122473	0.00023	25.5	mKIAA1225

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 280 293 PR00019 Leucine-rich repeat

IPR001611 646 659 PR00019 Leucine-rich repeat

HMMPfam IPR001849 124 223 PF00169 Pleckstrin-like

IPR001611 279 301 PF00560 Leucine-rich repeat

IPR001611 302 324 PF00560 Leucine-rich repeat

IPR001611 325 347 PF00560 Leucine-rich repeat

IPR001611 348 370 PF00560 Leucine-rich repeat

IPR001611 419 442 PF00560 Leucine-rich repeat

IPR001611 505 527 PF00560 Leucine-rich repeat

IPR001611 550 569 PF00560 Leucine-rich repeat

IPR001611 574 597 PF00560 Leucine-rich repeat

IPR001611 624 647 PF00560 Leucine-rich repeat

IPR001611 648 670 PF00560 Leucine-rich repeat

IPR001611 716 739 PF00560 Leucine-rich repeat

IPR001932 761 1002 PF00481 Protein phosphatase 2C-like

HMMSmart NULL 246 265 SM00364 NULL

NULL 277 299 SM00366 NULL

IPR003591 277 300 SM00369 Leucine-rich repeat

NULL 279 296 SM00364 NULL

NULL 300 322 SM00366 NULL

NULL 300 319 SM00364 NULL

NULL 323 345 SM00366 NULL

IPR003591 323 345 SM00369 Leucine-rich repeat

NULL 346 368 SM00366 NULL

IPR003591 346 369 SM00369 Leucine-rich repeat

NULL 346 365 SM00364 NULL

IPR003591 417 440 SM00369 Leucine-rich repeat

NULL 480 499 SM00364 NULL

NULL 503 522 SM00364 NULL

NULL 504 525 SM00366 NULL

IPR003591 504 526 SM00369 Leucine-rich repeat

NULL 526 545 SM00364 NULL

IPR003591 527 549 SM00369 Leucine-rich repeat

NULL 549 570 SM00366 NULL

IPR003591 550 571 SM00369 Leucine-rich repeat

NULL 550 567 SM00364 NULL

NULL 572 591 SM00364 NULL

IPR003591 574 595 SM00369 Leucine-rich repeat

NULL 622 641 SM00364 NULL

NULL 646 668 SM00366 NULL

IPR003591 646 669 SM00369 Leucine-rich repeat

NULL 646 665 SM00364 NULL

IPR001932 752 1007 SM00332 Protein phosphatase 2C-like

ProfileScan IPR001849 123 223 PS50003 Pleckstrin-like

IPR003591 535 606 PS50506 Leucine-rich repeat

IPR001932 764 841 PS50169 Protein phosphatase 2C-like

IPR001932 848 1012 PS50170 Protein phosphatase 2C-like

NULL 1055 1128 PS50324 NULL

NULL 1269 1306 PS50322 NULL

IPR000694 1281 1301 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	280	293	PR00019	Leucine-rich repeat
IPR001611	646	659	PR00019	Leucine-rich repeat
HMMPfam	IPR001849	124	223	PF00169	Pleckstrin-like
IPR001611	279	301	PF00560	Leucine-rich repeat
IPR001611	302	324	PF00560	Leucine-rich repeat
IPR001611	325	347	PF00560	Leucine-rich repeat
IPR001611	348	370	PF00560	Leucine-rich repeat
IPR001611	419	442	PF00560	Leucine-rich repeat
IPR001611	505	527	PF00560	Leucine-rich repeat
IPR001611	550	569	PF00560	Leucine-rich repeat
IPR001611	574	597	PF00560	Leucine-rich repeat
IPR001611	624	647	PF00560	Leucine-rich repeat
IPR001611	648	670	PF00560	Leucine-rich repeat
IPR001611	716	739	PF00560	Leucine-rich repeat
IPR001932	761	1002	PF00481	Protein phosphatase 2C-like
HMMSmart	NULL	246	265	SM00364	NULL
NULL	277	299	SM00366	NULL
IPR003591	277	300	SM00369	Leucine-rich repeat
NULL	279	296	SM00364	NULL
NULL	300	322	SM00366	NULL
NULL	300	319	SM00364	NULL
NULL	323	345	SM00366	NULL
IPR003591	323	345	SM00369	Leucine-rich repeat
NULL	346	368	SM00366	NULL
IPR003591	346	369	SM00369	Leucine-rich repeat
NULL	346	365	SM00364	NULL
IPR003591	417	440	SM00369	Leucine-rich repeat
NULL	480	499	SM00364	NULL
NULL	503	522	SM00364	NULL
NULL	504	525	SM00366	NULL
IPR003591	504	526	SM00369	Leucine-rich repeat
NULL	526	545	SM00364	NULL
IPR003591	527	549	SM00369	Leucine-rich repeat
NULL	549	570	SM00366	NULL
IPR003591	550	571	SM00369	Leucine-rich repeat
NULL	550	567	SM00364	NULL
NULL	572	591	SM00364	NULL
IPR003591	574	595	SM00369	Leucine-rich repeat
NULL	622	641	SM00364	NULL
NULL	646	668	SM00366	NULL
IPR003591	646	669	SM00369	Leucine-rich repeat
NULL	646	665	SM00364	NULL
IPR001932	752	1007	SM00332	Protein phosphatase 2C-like
ProfileScan	IPR001849	123	223	PS50003	Pleckstrin-like
IPR003591	535	606	PS50506	Leucine-rich repeat
IPR001932	764	841	PS50169	Protein phosphatase 2C-like
IPR001932	848	1012	PS50170	Protein phosphatase 2C-like
NULL	1055	1128	PS50324	NULL
NULL	1269	1306	PS50322	NULL
IPR000694	1281	1301	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	904 bp
Genome contig ID	gi65488608f_106014214
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TAATTTTTGTTATAATAAATATGAAATTTACAAGT
Flanking genome sequence (321136 - 321185)	----+--------+--------+--------+--------+----* ACTGAATCTATCTGCTTTTGTCTCAGCATCCAGGTGTGTCTCACAGCCAA

Gene/Protein Characteristic Table for mKIAA0606

Features of the cloned DNA sequence

Features of the protein sequence