ROUGE

Gene/Protein Characteristic Table for mKIAA4169

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220520
Description :	Neuronal-specific septin 3.
Clone Name :	mbg08918 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1715 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 868 bp

Genome contig ID gi65543215f_82233667
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAGACCTGATTTTAAAAGTATTTGCTCGGTTTGT
Flanking genome sequence
(107288 - 107337)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAAAGGAAGAGAAAGAAAGGAAGGGAACCAGTGCACTA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..844
Length: 281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM15664	2.4e-90	98.7	septin 3, isofo...	Rattus norvegicus
AAD21036	9e-88	97.0	G-septin beta [...	Rattus norvegicus
BAH13172	2.8e-86	100.0	unnamed protein...	Homo sapiens
CAQ07553	2.8e-86	100.0	septin 3 [Homo ...	Homo sapiens
AAG00519	3.2e-86	100.0	septin 3 isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122415	5.3e-65	74.4	mKIAA0991
D49382	7.2e-41	49.8	mKIAA0158
AK220447	3.6e-40	48.4	mKIAA4020
AB093215	1.4e-32	43.2	mKIAA0202
AK172894	1.8e-31	41.7	mKIAA0128

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 162 257 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 35 272 PF00735 Cell division/GTP binding protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	162	257	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	35	272	PF00735	Cell division/GTP binding protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	868 bp
Genome contig ID	gi65543215f_82233667
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAGACCTGATTTTAAAAGTATTTGCTCGGTTTGT
Flanking genome sequence (107288 - 107337)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAAGGAAGAGAAAGAAAGGAAGGGAACCAGTGCACTA

Gene/Protein Characteristic Table for mKIAA4169

Features of the cloned DNA sequence

Features of the protein sequence