ROUGE |
Gene/Protein Characteristic Table for mKIAA0991 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122415 |
---|---|
septin 9. MLL septin-like fusion. SL3-3 integration site 1. |
|
mph02064 [Vector Info] | |
Source : | Mouse embryonic tail |
Note : | We replaced mbg08918, former representative clones for mKIAA0991 with mph02064. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3579 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1759 bp Genome contig ID gi65527427f_116987546 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGAAATGTATTTCCTGAAATAAATGTTTCAAATACFlanking genome sequence
(195860 - 195909) ----+----*----+----*----+----*----+----*----+----*
AAACTTTTTTTCTGGAGTTCTCTTTGGCAAGACCTGTCTGGTCCATTAAA
KIAA Alignment based on: KIAA0991 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1820
Length: 605 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |