ROUGE

Gene/Protein Characteristic Table for mKIAA0991

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122415
Description :	septin 9. MLL septin-like fusion. SL3-3 integration site 1.
Clone Name :	mph02064 [Vector Info]
Source :	Mouse embryonic tail
Note :	We replaced mbg08918, former representative clones for mKIAA0991 with mph02064. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 3579 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1759 bp

Genome contig ID gi65527427f_116987546
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGAAATGTATTTCCTGAAATAAATGTTTCAAATAC
Flanking genome sequence
(195860 - 195909)
----+----*----+----*----+----*----+----*----+----*
AAACTTTTTTTCTGGAGTTCTCTTTGGCAAGACCTGTCTGGTCCATTAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0991 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0991	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1820
Length: 605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM13310	3.3e-196	100.0	septin 9 [Mus m...	Mus musculus
NP_114025	6.2e-191	96.7	septin 9 isofor...	Rattus norvegicus
EDM06717	1.7e-190	96.5	septin 9, isofo...	Rattus norvegicus
CAM13311	7.5e-190	100.0	septin 9 [Mus m...	Mus musculus
Q80UG5	7.7e-190	100.0	Septin-9; SL3-3...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220520	3.8e-39	74.4	mKIAA4169
AK220447	3.1e-35	48.2	mKIAA4020
D49382	1.7e-33	45.1	mKIAA0158
AK172894	3.6e-28	41.1	mKIAA0128
AB093215	5.6e-26	40.6	mKIAA0202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 450 544 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 315 594 PF00735 Cell division/GTP binding protein

ProfileScan IPR001687 320 338 PS50101 ATP/GTP-binding site motif A (P-loop)

ScanRegExp IPR001241 585 593 PS00177 DNA topoisomerase II

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	450	544	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	315	594	PF00735	Cell division/GTP binding protein
ProfileScan	IPR001687	320	338	PS50101	ATP/GTP-binding site motif A (P-loop)
ScanRegExp	IPR001241	585	593	PS00177	DNA topoisomerase II

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1759 bp
Genome contig ID	gi65527427f_116987546
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGAAATGTATTTCCTGAAATAAATGTTTCAAATAC
Flanking genome sequence (195860 - 195909)	----+--------+--------+--------+--------+----* AAACTTTTTTTCTGGAGTTCTCTTTGGCAAGACCTGTCTGGTCCATTAAA

Gene/Protein Characteristic Table for mKIAA0991

Features of the cloned DNA sequence

Features of the protein sequence