ROUGE

Gene/Protein Characteristic Table for mKIAA0158

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	D49382
Description :	Septin 2.
Clone Name :	mpm05359 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3207 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2034 bp

Genome contig ID gi65488608f_93206496
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AACCTTTTTCAATAAAGCACTATTGTTTAGATATT
Flanking genome sequence
(130728 - 130777)
----+----*----+----*----+----*----+----*----+----*
AAATGAGTAGTCCTCTTTTTGAGTAAAGTATGCGGGCCATTGTGAAGATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0158 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0158	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 70..1173
Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P42208	3.7e-140	100.0	Septin-2; Neura...	Mus musculus
XP_516208	1.4e-139	98.4	septin 2 [Pan t...	Pan troglodytes
BAG57759	1.4e-139	98.4	unnamed protein...	Homo sapiens
Q15019	7.5e-139	98.6	Septin-2; Neura...	Homo sapiens
Q5RA66	1.3e-138	98.3	Septin-2.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220447	1.6e-61	58.9	mKIAA4020
AK122415	9e-47	45.1	mKIAA0991
AK172894	6.3e-39	41.1	mKIAA0128
AB093215	1.2e-37	40.9	mKIAA0202
AK220520	4.4e-34	49.8	mKIAA4169

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 181 270 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 40 319 PF00735 Cell division/GTP binding protein

ProfileScan IPR001687 45 63 PS50101 ATP/GTP-binding site motif A (P-loop)

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	181	270	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	40	319	PF00735	Cell division/GTP binding protein
ProfileScan	IPR001687	45	63	PS50101	ATP/GTP-binding site motif A (P-loop)

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2034 bp
Genome contig ID	gi65488608f_93206496
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AACCTTTTTCAATAAAGCACTATTGTTTAGATATT
Flanking genome sequence (130728 - 130777)	----+--------+--------+--------+--------+----* AAATGAGTAGTCCTCTTTTTGAGTAAAGTATGCGGGCCATTGTGAAGATT

Gene/Protein Characteristic Table for mKIAA0158

Features of the cloned DNA sequence

Features of the protein sequence