ROUGE |
Gene/Protein Characteristic Table for mKIAA0891 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122396 |
---|---|
ubiquitin-specific protease 19. ubiquitin carboxyl-terminal hydrolase 19. ubiquitin thiolesterase 19. ubiquitin-specific processing protease 19. deubiquitinating enzyme 19. |
|
mfj56010 [Vector Info] | |
Source : | Mouse fetal brain |
Note : | We replaced mbg07856, former representative clones for mKIAA0891 with mfj56010. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4474 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 360 bp Genome contig ID gi65519420f_108441038 PolyA signal sequence
(AATAAA,-13) +----*----+----*----+----*----+----
TAAATATATTTTAAAAATAAATAATAAATAAGCTGFlanking genome sequence
(109849 - 109898) ----+----*----+----*----+----*----+----*----+----*
ACTTAGTGACTGATCCACAACATGTTATGGCTCCCTCCCCGCCCTCCTCA
KIAA Alignment based on: KIAA0891 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 26..4114
Length: 1362 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |