ROUGE

Gene/Protein Characteristic Table for mKIAA0891

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122396
Description :	ubiquitin-specific protease 19. ubiquitin carboxyl-terminal hydrolase 19. ubiquitin thiolesterase 19. ubiquitin-specific processing protease 19. deubiquitinating enzyme 19.
Clone Name :	mfj56010 [Vector Info]
Source :	Mouse fetal brain
Note :	We replaced mbg07856, former representative clones for mKIAA0891 with mfj56010. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 4474 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 360 bp

Genome contig ID gi65519420f_108441038
PolyA signal sequence
(AATAAA,-13)
+----*----+----*----+----*----+----
TAAATATATTTTAAAAATAAATAATAAATAAGCTG
Flanking genome sequence
(109849 - 109898)
----+----*----+----*----+----*----+----*----+----*
ACTTAGTGACTGATCCACAACATGTTATGGCTCCCTCCCCGCCCTCCTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0891 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0891	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 26..4114
Length: 1362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL21295	98.8	ubiquitin speci...	Mus musculus
BAE36025	100.0	unnamed protein...	Mus musculus
EDL21293	99.9	ubiquitin speci...	Mus musculus
BAE42739	99.6	unnamed protein...	Mus musculus
Q3UJD6	98.8	Ubiquitin carbo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220512	3.9e-33	44.8	mKIAA4155
AK122301	6e-32	34.3	mKIAA0529
AK220478	1.8e-31	42.8	mKIAA4085
AK122195	3.3e-20	26.6	mKIAA0055
AK173083	6.3e-08	27.9	mKIAA1003

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 575 1292 PF00443 Peptidase C19

IPR002893 872 914 PF01753 Zinc finger

ProfileScan IPR001394 578 1296 PS50235 Peptidase C19

ScanRegExp IPR001394 579 594 PS00972 Peptidase C19

IPR002893 872 914 PS01360 Zinc finger

IPR001394 1230 1247 PS00973 Peptidase C19

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	575	1292	PF00443	Peptidase C19
IPR002893	872	914	PF01753	Zinc finger
ProfileScan	IPR001394	578	1296	PS50235	Peptidase C19
ScanRegExp	IPR001394	579	594	PS00972	Peptidase C19
IPR002893	872	914	PS01360	Zinc finger
IPR001394	1230	1247	PS00973	Peptidase C19

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	360 bp
Genome contig ID	gi65519420f_108441038
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- TAAATATATTTTAAAAATAAATAATAAATAAGCTG
Flanking genome sequence (109849 - 109898)	----+--------+--------+--------+--------+----* ACTTAGTGACTGATCCACAACATGTTATGGCTCCCTCCCCGCCCTCCTCA

Gene/Protein Characteristic Table for mKIAA0891

Features of the cloned DNA sequence

Features of the protein sequence