ROUGE |
Gene/Protein Characteristic Table for mKIAA4136 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220501 |
---|---|
solute carrier family 4, sodium bicarbonate cotransporter-like, member 10. | |
mbg09982 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5483 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2031 bp Genome contig ID gi66880554f_61801951 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GAAATGTTATGTGGAAATAAATATTTATCCTACCTFlanking genome sequence
(380181 - 380230) ----+----*----+----*----+----*----+----*----+----*
ACTTTTCATGCTTATTTTAAAGTGTGTACAATGTGTCTTATCTTTATTTT
Features of the protein sequence |
Description | |
Coding region: 36..3449
Length: 1138 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |