ROUGE |
Gene/Protein Characteristic Table for mKIAA4135 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220185 |
---|---|
mpf00123 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6209 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3760 bp Genome contig ID gi66880665f_80134679 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
GCAGCAAGAAATTAATTAAATTTGTACATACCATGFlanking genome sequence
(160294 - 160343) ----+----*----+----*----+----*----+----*----+----*
TCTCTTAGATTTCTGTGTATGTTGTGAAGGACATTATTTTGAGAAGAAAT
Features of the protein sequence |
Description | |
Coding region: 278..2446
Length: 723 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |