ROUGE

Gene/Protein Characteristic Table for mKIAA4130

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK083624
Description :	Transforming protein RhoA.
Clone Name :	mie08042 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1862 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1109 bp

Genome contig ID gi65519420f_108276222
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AATTTTTCCAACTAATAGAATAAAGGCAGTTTTCT
Flanking genome sequence
(131375 - 131424)
----+----*----+----*----+----*----+----*----+----*
AAATTTCCTGTATTCTCTTGTGTGTTGCTTTCGCCGGAAAGACTCCCCTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 169..750
Length: 194 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9QUI0	2e-81	100.0	Transforming pr...	Mus musculus
P61585	2.3e-81	99.5	Transforming pr...	Bos taurus
BAE38228	2.3e-81	99.5	unnamed protein...	Mus musculus
AAV38672	2.4e-81	99.5	ras homolog gen...	synthetic construct
1X86	2.4e-81	99.5	Crystal Structu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122354	5.4e-20	39.5	mKIAA0717
AK129477	7.7e-14	31.1	mKIAA3012
AK172891	1.1e-12	28.5	mKIAA0118

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 7 28 PR00449 Ras GTPase

IPR001806 30 46 PR00449 Ras GTPase

IPR001806 47 69 PR00449 Ras GTPase

IPR001806 109 122 PR00449 Ras GTPase

IPR001806 157 179 PR00449 Ras GTPase

HMMPfam IPR001806 8 181 PF00071 Ras GTPase

HMMSmart IPR003579 8 182 SM00175 Ras small GTPase

IPR003577 8 182 SM00173 Ras small GTPase

IPR003578 9 182 SM00174 Ras small GTPase

HMMTigr IPR005225 4 160 TIGR00231 Small GTP-binding protein domain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	7	28	PR00449	Ras GTPase
IPR001806	30	46	PR00449	Ras GTPase
IPR001806	47	69	PR00449	Ras GTPase
IPR001806	109	122	PR00449	Ras GTPase
IPR001806	157	179	PR00449	Ras GTPase
HMMPfam	IPR001806	8	181	PF00071	Ras GTPase
HMMSmart	IPR003579	8	182	SM00175	Ras small GTPase
IPR003577	8	182	SM00173	Ras small GTPase
IPR003578	9	182	SM00174	Ras small GTPase
HMMTigr	IPR005225	4	160	TIGR00231	Small GTP-binding protein domain

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1109 bp
Genome contig ID	gi65519420f_108276222
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AATTTTTCCAACTAATAGAATAAAGGCAGTTTTCT
Flanking genome sequence (131375 - 131424)	----+--------+--------+--------+--------+----* AAATTTCCTGTATTCTCTTGTGTGTTGCTTTCGCCGGAAAGACTCCCCTG

Gene/Protein Characteristic Table for mKIAA4130

Features of the cloned DNA sequence

Features of the protein sequence