Gene/Protein Characteristic Table for mKIAA4130

Length: 1862 bp

Restriction map

Length of 3'UTR	1109 bp
Genome contig ID	gi65519420f_108276222
PolyA signal sequence (AATAAA,-17)	+----*----+----*----+----*----+---- AATTTTTCCAACTAATAGAATAAAGGCAGTTTTCT
Flanking genome sequence (131375 - 131424)	----+----*----+----*----+----*----+----*----+----* AAATTTCCTGTATTCTCTTGTGTGTTGCTTTCGCCGGAAAGACTCCCCTG

Coding region: 169..750

Length: 194 aa

Entry Exp ID% Protein Source Q9QUI0 2e-81 100.0 Transforming pr... Mus musculus P61585 2.3e-81 99.5 Transforming pr... Bos taurus BAE38228 2.3e-81 99.5 unnamed protein... Mus musculus AAV38672 2.4e-81 99.5 ras homolog gen... synthetic construct 1X86 2.4e-81 99.5 Crystal Structu... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122354 5.4e-20 39.5 mKIAA0717 AK129477 7.7e-14 31.1 mKIAA3012 AK172891 1.1e-12 28.5 mKIAA0118

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	7	28	PR00449	Ras GTPase
	IPR001806	30	46	PR00449	Ras GTPase
	IPR001806	47	69	PR00449	Ras GTPase
	IPR001806	109	122	PR00449	Ras GTPase
	IPR001806	157	179	PR00449	Ras GTPase
HMMPfam	IPR001806	8	181	PF00071	Ras GTPase
HMMSmart	IPR003579	8	182	SM00175	Ras small GTPase
	IPR003577	8	182	SM00173	Ras small GTPase
	IPR003578	9	182	SM00174	Ras small GTPase
HMMTigr	IPR005225	4	160	TIGR00231	Small GTP-binding protein domain

Method	From	To	amino acid sequence
-	-	-	-