ROUGE

Gene/Protein Characteristic Table for mKIAA3012

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129477
Description :	Ras-related protein Rab-1A.
Clone Name :	mph02039 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2819 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2015 bp

Genome contig ID gi65527427f_19996238
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
ATTTCACAATAAAATCATAGTTTACTTTGTATTAT
Flanking genome sequence
(125413 - 125462)
----+----*----+----*----+----*----+----*----+----*
AGATGCGCTTGTTGGGTCTATTCATCCTTATATATAAAAAGGTAACTGGA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 43..801
Length: 253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW99923	1.5e-78	99.5	RAB1A, member R...	Homo sapiens
P62820	2.9e-73	99.5	Ras-related pro...	Homo sapiens
AAV38334	2.9e-73	99.5	RAB1A, member R...	synthetic construct
BAE30098	5.8e-73	99.0	unnamed protein...	Mus musculus
ACH44401	8.9e-73	99.0	putative RAB1B ...	Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172891	5.2e-25	35.5	mKIAA0118
AK083624	1.4e-11	31.1	mKIAA4130

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 60 81 PR00449 Ras GTPase

IPR001806 83 99 PR00449 Ras GTPase

IPR001806 101 123 PR00449 Ras GTPase

IPR001806 163 176 PR00449 Ras GTPase

IPR001806 198 220 PR00449 Ras GTPase

HMMPfam IPR001806 61 222 PF00071 Ras GTPase

HMMSmart IPR003577 57 223 SM00173 Ras small GTPase

IPR003579 60 223 SM00175 Ras small GTPase

IPR003578 62 221 SM00174 Ras small GTPase

IPR002041 65 253 SM00176 GTP-binding nuclear protein Ran

HMMTigr IPR005225 57 218 TIGR00231 Small GTP-binding protein domain

ProfileScan NULL 24 44 PS50315 NULL

ScanRegExp IPR002078 62 75 PS00675 Sigma-54 factor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	60	81	PR00449	Ras GTPase
IPR001806	83	99	PR00449	Ras GTPase
IPR001806	101	123	PR00449	Ras GTPase
IPR001806	163	176	PR00449	Ras GTPase
IPR001806	198	220	PR00449	Ras GTPase
HMMPfam	IPR001806	61	222	PF00071	Ras GTPase
HMMSmart	IPR003577	57	223	SM00173	Ras small GTPase
IPR003579	60	223	SM00175	Ras small GTPase
IPR003578	62	221	SM00174	Ras small GTPase
IPR002041	65	253	SM00176	GTP-binding nuclear protein Ran
HMMTigr	IPR005225	57	218	TIGR00231	Small GTP-binding protein domain
ProfileScan	NULL	24	44	PS50315	NULL
ScanRegExp	IPR002078	62	75	PS00675	Sigma-54 factor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2015 bp
Genome contig ID	gi65527427f_19996238
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ATTTCACAATAAAATCATAGTTTACTTTGTATTAT
Flanking genome sequence (125413 - 125462)	----+--------+--------+--------+--------+----* AGATGCGCTTGTTGGGTCTATTCATCCTTATATATAAAAAGGTAACTGGA

Gene/Protein Characteristic Table for mKIAA3012

Features of the cloned DNA sequence

Features of the protein sequence