ROUGE

Gene/Protein Characteristic Table for mKIAA0717

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122354
Description :	Rho-related BTB domain-containing protein 2.
Clone Name :	mbg08106 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5782 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3503 bp

Genome contig ID gi65540054r_64006406
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTTTTGTGGTTTTTAACAGTTATTGAGAAAAAT
Flanking genome sequence
(99916 - 99867)
----+----*----+----*----+----*----+----*----+----*
AAAAAATAAAAAAAAATTTTAAAAGGCGGGGCAGTGGTGGCACACGCCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0717 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0717	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 429..2279
Length: 616 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519653	97.4	Rho-related BTB...	Pan troglodytes
BAE42375	99.8	unnamed protein...	Mus musculus
BAC29946	100.0	unnamed protein...	Mus musculus
BAC38133	99.8	unnamed protein...	Mus musculus
AAH26836	99.7	Rhobtb2 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173015	4.2e-34	58.6	mKIAA0740
AK083624	3.1e-12	39.5	mKIAA4130

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001806 40 233 PF00071 Ras GTPase

IPR000210 284 496 PF00651 BTB/POZ

IPR000210 514 614 PF00651 BTB/POZ

HMMSmart IPR003577 36 234 SM00173 Ras small GTPase

IPR003579 39 234 SM00175 Ras small GTPase

IPR003578 41 234 SM00174 Ras small GTPase

IPR000210 290 496 SM00225 BTB/POZ

IPR000210 524 616 SM00225 BTB/POZ

HMMTigr IPR005225 36 229 TIGR00231 Small GTP-binding protein domain

ProfileScan IPR000210 290 320 PS50097 BTB/POZ

NULL 343 358 PS50316 NULL

IPR000210 524 591 PS50097 BTB/POZ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001806	40	233	PF00071	Ras GTPase
IPR000210	284	496	PF00651	BTB/POZ
IPR000210	514	614	PF00651	BTB/POZ
HMMSmart	IPR003577	36	234	SM00173	Ras small GTPase
IPR003579	39	234	SM00175	Ras small GTPase
IPR003578	41	234	SM00174	Ras small GTPase
IPR000210	290	496	SM00225	BTB/POZ
IPR000210	524	616	SM00225	BTB/POZ
HMMTigr	IPR005225	36	229	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR000210	290	320	PS50097	BTB/POZ
NULL	343	358	PS50316	NULL
IPR000210	524	591	PS50097	BTB/POZ

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3503 bp
Genome contig ID	gi65540054r_64006406
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTTTTGTGGTTTTTAACAGTTATTGAGAAAAAT
Flanking genome sequence (99916 - 99867)	----+--------+--------+--------+--------+----* AAAAAATAAAAAAAAATTTTAAAAGGCGGGGCAGTGGTGGCACACGCCTT

Gene/Protein Characteristic Table for mKIAA0717

Features of the cloned DNA sequence

Features of the protein sequence