Gene/Protein Characteristic Table for mKIAA4122

Length: 3112 bp

Restriction map

Length of 3'UTR	440 bp
Genome contig ID	gi65504368f_47556050
PolyA signal sequence (AATAAA,-34)	+----*----+----*----+----*----+---- AAATAAAGAAAATTAAAGGATTTCTGTACAAGTTG
Flanking genome sequence (171717 - 171766)	----+----*----+----*----+----*----+----*----+----* CATTTGGTTTTGTTTTAAGTTTTTCTAATTTCTATATGTAAATAAAAGAT

Coding region: 300..2669

Length: 790 aa

Entry Exp ID% Protein Source Q9WTX6 0 99.9 Cullin-1; Short... Mus musculus BAE27601 0 99.7 unnamed protein... Mus musculus XP_001505554 0 99.7 similar to SCF ... Ornithorhynchus... XP_848402 0 99.7 similar to Cull... Canis lupus fam... Q13616 0 99.7 Cullin-1; Short... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220287 3.8e-83 36.2 mKIAA4106 AK129174 7.6e-29 30.7 mKIAA0617 AB093259 2.6e-14 29.7 mKIAA0695 AK129351 7.3e-06 20.2 mKIAA1406 AK172882 0.00046 22.6 mKIAA0076

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	35	690	PF00888	Cullin
HMMSmart	IPR001373	461	608	SM00182	Cullin
ProfileScan	IPR001373	431	658	PS50069	Cullin
ScanRegExp	IPR001373	763	790	PS01256	Cullin

Method	From	To	amino acid sequence
-	-	-	-